ID: 1140042567_1140042572

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1140042567 1140042572
Species Human (GRCh38) Human (GRCh38)
Location 16:71418159-71418181 16:71418172-71418194
Sequence CCAGCCTAGTGCCTGGGCTTCAG TGGGCTTCAGCTGAGAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 338} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!