ID: 1140046496_1140046503

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1140046496 1140046503
Species Human (GRCh38) Human (GRCh38)
Location 16:71443201-71443223 16:71443223-71443245
Sequence CCAGGAGCCTGAGGCTGAGAGGC CCCAGGGTCACATGGGACATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!