ID: 1140047251_1140047258

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1140047251 1140047258
Species Human (GRCh38) Human (GRCh38)
Location 16:71449252-71449274 16:71449293-71449315
Sequence CCACACATCTTACACTGATAGGG TGTCTGATGTGTGATATAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 255} {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!