ID: 1140051341_1140051345

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1140051341 1140051345
Species Human (GRCh38) Human (GRCh38)
Location 16:71484251-71484273 16:71484296-71484318
Sequence CCGGAATCTAGAGCAGGAACTGG CTGTGGCCCAATGAGCAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 211} {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!