ID: 1140070937_1140070945

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1140070937 1140070945
Species Human (GRCh38) Human (GRCh38)
Location 16:71649134-71649156 16:71649152-71649174
Sequence CCATTGGAGAGTTTCTTCCCATA CCATAGAGGCAGGAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 181} {0: 1, 1: 0, 2: 3, 3: 48, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!