ID: 1140078579_1140078599

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1140078579 1140078599
Species Human (GRCh38) Human (GRCh38)
Location 16:71723778-71723800 16:71723830-71723852
Sequence CCGGATCCCTCCCGGCCGGCGGC TCCAGCGGGCCCGCGGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 141} {0: 1, 1: 0, 2: 1, 3: 27, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!