ID: 1140079300_1140079304

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1140079300 1140079304
Species Human (GRCh38) Human (GRCh38)
Location 16:71729614-71729636 16:71729632-71729654
Sequence CCAGTTCTACAAGCAGCCCCACT CCACTCTCCCGAGCCAAAGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 130} {0: 1, 1: 1, 2: 1, 3: 9, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!