ID: 1140095056_1140095062

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1140095056 1140095062
Species Human (GRCh38) Human (GRCh38)
Location 16:71868037-71868059 16:71868070-71868092
Sequence CCTGGTGGTCACAAGGAAAAATA CAGCTGGGCAGCATATCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 240} {0: 1, 1: 0, 2: 0, 3: 17, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!