ID: 1140132190_1140132195

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1140132190 1140132195
Species Human (GRCh38) Human (GRCh38)
Location 16:72173064-72173086 16:72173086-72173108
Sequence CCACCAAGCTTCTAAACCTGGTT TCAGCACCTCACTGGAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130} {0: 1, 1: 0, 2: 2, 3: 18, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!