ID: 1140224474_1140224485

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1140224474 1140224485
Species Human (GRCh38) Human (GRCh38)
Location 16:73066872-73066894 16:73066913-73066935
Sequence CCCCCAGCCCCGCGGGATACGGA GGGACCCTGAACCCAACTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 58} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!