ID: 1140293302_1140293306

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1140293302 1140293306
Species Human (GRCh38) Human (GRCh38)
Location 16:73684675-73684697 16:73684697-73684719
Sequence CCCCTGCAATCACAAGGGTCCTT TTTTTTTTTTTTTTTTTTTTTGG
Strand - +
Off-target summary No data {0: 12750, 1: 14510, 2: 25740, 3: 52715, 4: 189344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!