ID: 1140306423_1140306429

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1140306423 1140306429
Species Human (GRCh38) Human (GRCh38)
Location 16:73807116-73807138 16:73807133-73807155
Sequence CCAGCTGGAGCACCCGAGAAGAG GAAGAGGCAGCAGGGACCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!