ID: 1140307143_1140307153 |
View in Genome Browser |
Spacer: 15 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1140307143 | 1140307153 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 16:73813743-73813765 | 16:73813781-73813803 |
| Sequence | CCCTCCTCTTCCTGTACCTCAGA | GATACTCAAGAACTCCTTCCCGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 7, 4: 89} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||