ID: 1140364150_1140364162

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1140364150 1140364162
Species Human (GRCh38) Human (GRCh38)
Location 16:74368362-74368384 16:74368412-74368434
Sequence CCCGCGGCCTCTTTGCCACCCTC TTAGGGCCGTTTTAGAACCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 2, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!