ID: 1140372782_1140372796

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1140372782 1140372796
Species Human (GRCh38) Human (GRCh38)
Location 16:74421984-74422006 16:74422006-74422028
Sequence CCCCGGTGCCCACCACCCTCACC CCACGTGACTACAGGCCAGGGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 3, 3: 43, 4: 611} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!