ID: 1140379884_1140379890

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1140379884 1140379890
Species Human (GRCh38) Human (GRCh38)
Location 16:74477091-74477113 16:74477128-74477150
Sequence CCTGTAAGAGGCAGGCCATACCA TTTAATAAGCAACAGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78} {0: 1, 1: 0, 2: 5, 3: 29, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!