ID: 1140409000_1140409012

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1140409000 1140409012
Species Human (GRCh38) Human (GRCh38)
Location 16:74730144-74730166 16:74730160-74730182
Sequence CCCATCACAGCCTGGGAGCAGGG AGCAGGGGGGTGGGGGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 295} {0: 1, 1: 0, 2: 3, 3: 60, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!