ID: 1140423607_1140423617

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1140423607 1140423617
Species Human (GRCh38) Human (GRCh38)
Location 16:74841976-74841998 16:74842020-74842042
Sequence CCTGAGATTTGCTTCAAACCAAT AAGAGAACACAGATGAAACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 58, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!