ID: 1140441857_1140441860

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1140441857 1140441860
Species Human (GRCh38) Human (GRCh38)
Location 16:74993972-74993994 16:74993993-74994015
Sequence CCTCTTTCAGTTCCTTGAATATG TGCCATGTTCTCTCACATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 663} {0: 1, 1: 0, 2: 0, 3: 33, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!