ID: 1140442828_1140442836

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1140442828 1140442836
Species Human (GRCh38) Human (GRCh38)
Location 16:74999892-74999914 16:74999912-74999934
Sequence CCGCCTCCCGGGGCACCGGCGAC GACTCCGAGAGGGCGCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 173} {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!