|
Left Crispr |
Right Crispr |
| Crispr ID |
1140449757 |
1140449773 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:75061271-75061293
|
16:75061303-75061325
|
| Sequence |
CCCATTAACCATCCCCACCTCCC |
CCAGTACCCTTCCCAACCTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 119, 1: 391, 2: 760, 3: 999, 4: 1328} |
{0: 2, 1: 35, 2: 467, 3: 1094, 4: 1761} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|