ID: 1140451920_1140451927

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1140451920 1140451927
Species Human (GRCh38) Human (GRCh38)
Location 16:75077754-75077776 16:75077777-75077799
Sequence CCATTTCCTTGTCTTTCCCAGCT CCTGGAGGCCACGCTTTCCTTGG
Strand - +
Off-target summary {0: 3, 1: 17, 2: 141, 3: 354, 4: 1374} {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!