ID: 1140452799_1140452807

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1140452799 1140452807
Species Human (GRCh38) Human (GRCh38)
Location 16:75084684-75084706 16:75084726-75084748
Sequence CCGCTGCCCTTGTCCTCACGGTG CTGTTCTTCTAATACATCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 241} {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!