ID: 1140462197_1140462211

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1140462197 1140462211
Species Human (GRCh38) Human (GRCh38)
Location 16:75148780-75148802 16:75148821-75148843
Sequence CCGGGGTTGCCCGGCGCTCGCCT GCACGCCTGGCCGAACGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82} {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!