ID: 1140476216_1140476223

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1140476216 1140476223
Species Human (GRCh38) Human (GRCh38)
Location 16:75240365-75240387 16:75240404-75240426
Sequence CCGTGCCACCGTAATGAAGGCAT CCCAGGGCCCGCCCCAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 54} {0: 1, 1: 0, 2: 4, 3: 62, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!