ID: 1140504813_1140504824

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1140504813 1140504824
Species Human (GRCh38) Human (GRCh38)
Location 16:75464572-75464594 16:75464609-75464631
Sequence CCGCTGCCGCCGCTCCCCTCGCG CATTCACCACAGAGAAATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 40, 4: 431} {0: 1, 1: 0, 2: 2, 3: 17, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!