ID: 1140504814_1140504823

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1140504814 1140504823
Species Human (GRCh38) Human (GRCh38)
Location 16:75464578-75464600 16:75464608-75464630
Sequence CCGCCGCTCCCCTCGCGCTCCAT CCATTCACCACAGAGAAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 252} {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!