ID: 1140515535_1140515540

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1140515535 1140515540
Species Human (GRCh38) Human (GRCh38)
Location 16:75538749-75538771 16:75538773-75538795
Sequence CCATGTGTTCTTGGAGGAGACTG CCACATCCTCAGGAGGTGAATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 42, 4: 438} {0: 1, 1: 0, 2: 1, 3: 20, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!