|
Left Crispr |
Right Crispr |
| Crispr ID |
1140522850 |
1140522855 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:75597121-75597143
|
16:75597147-75597169
|
| Sequence |
CCCCAAAACTTCATGTCTACCTG |
CCTCAGAATGTGACTTTAGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 12, 3: 61, 4: 316} |
{0: 4, 1: 68, 2: 857, 3: 1937, 4: 2837} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|