ID: 1140601763_1140601764

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1140601763 1140601764
Species Human (GRCh38) Human (GRCh38)
Location 16:76485042-76485064 16:76485055-76485077
Sequence CCAAACATAGTTTCAAAATAATT CAAAATAATTAGTTAGAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 686} {0: 1, 1: 0, 2: 0, 3: 25, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!