ID: 1140602914_1140602919

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1140602914 1140602919
Species Human (GRCh38) Human (GRCh38)
Location 16:76500050-76500072 16:76500068-76500090
Sequence CCCGTTCTCAATGAGCTGTTGGG TTGGGTACACCTCCCTGACGGGG
Strand - +
Off-target summary {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130} {0: 4, 1: 933, 2: 947, 3: 414, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!