|
Left Crispr |
Right Crispr |
| Crispr ID |
1140602914 |
1140602930 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:76500050-76500072
|
16:76500087-76500109
|
| Sequence |
CCCGTTCTCAATGAGCTGTTGGG |
GGGGTGGCGGCGGGGCAGAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1398, 1: 571, 2: 139, 3: 41, 4: 130} |
{0: 6, 1: 297, 2: 1350, 3: 1531, 4: 2710} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|