ID: 1140613246_1140613248

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1140613246 1140613248
Species Human (GRCh38) Human (GRCh38)
Location 16:76626664-76626686 16:76626679-76626701
Sequence CCAATGGCAGGTTCACCAATCTG CCAATCTGTCCCTGTGCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120} {0: 1, 1: 0, 2: 3, 3: 15, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!