ID: 1140664304_1140664317

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1140664304 1140664317
Species Human (GRCh38) Human (GRCh38)
Location 16:77213671-77213693 16:77213724-77213746
Sequence CCTAGGAAGTGGTATCTGAGCGG CCCTGTGGGTGTCTGGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 114} {0: 1, 1: 1, 2: 7, 3: 66, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!