ID: 1140700259_1140700277

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1140700259 1140700277
Species Human (GRCh38) Human (GRCh38)
Location 16:77575044-77575066 16:77575095-77575117
Sequence CCTCTCATCTCCCCACGGTGCTC CCTGCCAAGGGCTGTGGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!