ID: 1140721979_1140721983

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1140721979 1140721983
Species Human (GRCh38) Human (GRCh38)
Location 16:77780316-77780338 16:77780342-77780364
Sequence CCAACTGGATATAGGCCAATCCA ATAAAAGGAACAAAACTTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!