ID: 1140722938_1140722940

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1140722938 1140722940
Species Human (GRCh38) Human (GRCh38)
Location 16:77787831-77787853 16:77787863-77787885
Sequence CCTGATAACAAAACAAAACGCCA CTGTGTATGTGCATGCATGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 23, 3: 130, 4: 708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!