ID: 1140728957_1140728963

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1140728957 1140728963
Species Human (GRCh38) Human (GRCh38)
Location 16:77838892-77838914 16:77838925-77838947
Sequence CCCATCTCTTTCTTTCAGCATCT AGCCCTGGGGGTAACTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 627} {0: 1, 1: 0, 2: 1, 3: 10, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!