ID: 1140733082_1140733087

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1140733082 1140733087
Species Human (GRCh38) Human (GRCh38)
Location 16:77873970-77873992 16:77873997-77874019
Sequence CCTGCTTCTCTGCAGAACCAGAG GCGGACAGAGCAACAGGTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 291} {0: 1, 1: 0, 2: 0, 3: 19, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!