ID: 1140742133_1140742138

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1140742133 1140742138
Species Human (GRCh38) Human (GRCh38)
Location 16:77951083-77951105 16:77951112-77951134
Sequence CCATCCACCTGAAGGAAATACAG GAAAGATACGTTGGCTGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197} {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!