ID: 1140771744_1140771749

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1140771744 1140771749
Species Human (GRCh38) Human (GRCh38)
Location 16:78211899-78211921 16:78211914-78211936
Sequence CCCTACCCTCTCTGAGCTGAGTT GCTGAGTTTGTTTTGGACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 266} {0: 1, 1: 0, 2: 1, 3: 17, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!