ID: 1140772487_1140772489

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1140772487 1140772489
Species Human (GRCh38) Human (GRCh38)
Location 16:78217599-78217621 16:78217635-78217657
Sequence CCGAGAAACTTAACAGAGGGCTC ATTGAAAGTTACTAGGTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129} {0: 1, 1: 0, 2: 9, 3: 23, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!