ID: 1140772487_1140772490

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1140772487 1140772490
Species Human (GRCh38) Human (GRCh38)
Location 16:78217599-78217621 16:78217643-78217665
Sequence CCGAGAAACTTAACAGAGGGCTC TTACTAGGTGCCAGGTGTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129} {0: 1, 1: 0, 2: 0, 3: 13, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!