ID: 1140787762_1140787765

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1140787762 1140787765
Species Human (GRCh38) Human (GRCh38)
Location 16:78360234-78360256 16:78360287-78360309
Sequence CCATTTCACTGGTGTTCTGTCAA TAGAAGTTGGAGAAGTAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 191} {0: 1, 1: 1, 2: 4, 3: 45, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!