ID: 1140794559_1140794566

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1140794559 1140794566
Species Human (GRCh38) Human (GRCh38)
Location 16:78425008-78425030 16:78425038-78425060
Sequence CCGCTCAGCTCCTGCCCGTGTCA CTCCTCAGAGTCCCATCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 283} {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!