ID: 1140797467_1140797474

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1140797467 1140797474
Species Human (GRCh38) Human (GRCh38)
Location 16:78452969-78452991 16:78453003-78453025
Sequence CCTTCTTGGCCTAAGTGATCCTC TCCCGAGTAGCTGGGATTACAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 67, 3: 1165, 4: 8662} {0: 44204, 1: 206428, 2: 253404, 3: 185491, 4: 423321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!