|
Left Crispr |
Right Crispr |
Crispr ID |
1140797467 |
1140797474 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:78452969-78452991
|
16:78453003-78453025
|
Sequence |
CCTTCTTGGCCTAAGTGATCCTC |
TCCCGAGTAGCTGGGATTACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 3, 2: 67, 3: 1165, 4: 8662} |
{0: 44204, 1: 206428, 2: 253404, 3: 185491, 4: 423321} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|