|
Left Crispr |
Right Crispr |
| Crispr ID |
1140842797 |
1140842802 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:78856516-78856538
|
16:78856548-78856570
|
| Sequence |
CCCTGTAATAGCAGCTACTCAGG |
CAGGAGAATCCCTTGAACCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 19, 2: 931, 3: 2404, 4: 3989} |
{0: 1871, 1: 82236, 2: 160444, 3: 207287, 4: 165273} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|