ID: 1140863498_1140863500

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1140863498 1140863500
Species Human (GRCh38) Human (GRCh38)
Location 16:79039786-79039808 16:79039836-79039858
Sequence CCTTCTCTGAACCTTTTTGCGTG CTGACTCATCTCTACCAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 177} {0: 1, 1: 0, 2: 0, 3: 12, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!