ID: 1140864810_1140864812

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1140864810 1140864812
Species Human (GRCh38) Human (GRCh38)
Location 16:79050608-79050630 16:79050644-79050666
Sequence CCAAGACTGCACTTGTATTTGAG TGCTGAGGAATTTTAAGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115} {0: 1, 1: 0, 2: 2, 3: 27, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!