ID: 1140873558_1140873561

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1140873558 1140873561
Species Human (GRCh38) Human (GRCh38)
Location 16:79129025-79129047 16:79129077-79129099
Sequence CCAAGTTCATTGTCCTGACACAG TTGCAAGTATGGATCTTGATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 144} {0: 1, 1: 0, 2: 0, 3: 19, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!